FIRI Sci Club

2019.05.17
1. Raman spectro
https://www.nanophoton.net/raman-spectroscopy/lessons/lesson-1
2. Tool
- Learn vocabulary by the Free Dictionary
- Tra từ đồng nghĩa (Synonyms) và trái nghĩa (Antonyms) tại Thesaurus
- Xây dựng dữ liệu NC:
            (1) Tìm kiếm và tải báo
                tại 1 thời điểm tìm về cập nhật dưới 100 bài báo liên quan đến vấn đề NC
            (- Lưu ý vấn đề từ khóa - nguồn thông tin - tạp chí chuyên ngành)
             (2) Scan abstract
             - đọc abstract và tên = nội dung nghiên cứu > hình dung được bức tranh nghiên cứu hiện tại
             - Xây dựng mydatase base dựa trên cơ sở này. (Endnote, Mendeley, Zotero, etc)
             - Viết background và State of the art
             (3) Cập nhật thụ động bài báo = đăng ký tạp chí chuyên ngành - cập nhật  trends nghiên cứu.
              - Ví dụ (list tạp chí nghiên cứu các vấn đề)
           
3. Request topic:
-
 

PCR amplification not working?

By the way in the PCR reaction include:
DNA template (pure or include inhibition compounds)
Primer
Master mix (include dNTP, DNA polymerase, buffer - it could be optimized)

The reaction happen in thermometer:
Denaturing - when the double-stranded template DNA is heated to separate it into two single strands.

Annealing - when the temperature is lowered to enable the DNA primers to attach to the template DNA.

Extending - when the temperature is raised and the new strand of DNA is made by the Taq polymerase enzyme

notice: 
Denaturing depend on enzyme - it could be 94oC eg. Dreamtaq or 98oC eg. Phusion
Annealing - it depend on primer to decide the opt temperature of annealing - low temperature easy to hold primer with DNA but less specific - high temperature need more link between primer and DNA to hold so it more specific. (from it possibly from 48oC to 64oC depend on each primer and ration AT-GC, more GC should be higher temp- was calculating by online tool)
Extending - 72oC for 1-2min depend on speech reaction of enzyme (1kb/min or 1,5kb/min) and the length of product (500bp or 1kbp) to decide the opt time to extend.

- the temperature to optimize- form low to high - to define the high temp give the acurrency result.
- the amount of DNA template (less or more) define easy or difficult to annealing the pcr products (use raw extract DNA in phenol-chloroform or use purified DNA)
- the component of reaction should be control and avoid any inhibition to PCR.

Primers for amplifying and sequencing fungal rDNA ITS region

PCR primers

To identify ectomycorrhizal (ECM) fungi, ITS1-ITS4, ITS1F-ITS4, and ITS1F-ITS4B are the most widely used primer pairs for PCR. However, using default annealing temperature of 55 degrees centigrade, we have met several difficulties using all of the primer pairs mentioned above.

• ITS1-ITS4 is a pair of universal primers that co-amplifies angiosperm DNA. In case the DNA is extracted from sporocarps, pure cultures, or ECM of conifers, this primer pair amplifies the highest amount of target (ca 600 bp). To our knowledge, ITS1-ITS4 can amplify DNA from nearly all (ECM) fungi.
• ITS1F-ITS4. ITS1F is a fungal specific primer. However, together with ITS4, ITS1F can result in weak amplification of highly concentrated pure angiosperm DNA. We have not observed plant bands on gel (slower) if DNA is extracted from ECM. A problem with ITS1F-ITS4 is gel smearing, that is production of numerous hardly separable bands. Raising annealing temperature a few degrees might resolve this problem. ITS1F tends to result in less target DNA compared to ITS1, but it has proved efficient in amplifying all ECM fungi.
• ITS1F-ITS4B is a pair of strongly basidiomycete-specific primers. In addition to asco-mycetous ECM fungi, Sebacinaceae, Atheliaceae, and some Cortinariaceae species cannot be amplified. We strongly disencourage usage of ITS1F-ITS4B for ECM community studies.

ITS1 or ITS1F together with LR21 appear the most promising primer combination that does not co-amplify plant DNA. These primer pairs amplify nearly all ECM fungi, typically resulting in some 850-900 bp PCR products.

Sequencing primers

In sequencing we have usually applied primers ITS1, ITS2, ITS3, ITS4. ITS2 and ITS3 usually give the best chromatograms. In case of amplification using primer pair ITS1(F)-LR21, ITS3 gives ca 550 bp sequence, covering both ITS2 and ca 200 bp of 28S rDNA. The latter offers more taxonomic opportunities in cases where ITS2 is not matched by other taxa. Sequencing the whole 850 bp with primers ITS1 and LR21 appears to be one of the best solutions.

Primer name	Position in gene	Sequence	Gene/locus	Direction	Target	Remarks	Reference
Universal, fungal primers rDNA
5.8S_Fungi		CAAGAGATCCGTTGTTGAAAGTT	ITS	rev	Fungi	for paleo-DNA	Epp et al. 2012
58A1F	40	GCATCGATGAAGAACGC	ITS	fwd	Universal	upgrade of ITS3, excludes Glomeromycota	Martin & Rygiewicz 2005
CTB6	39	GCATATCAATAAGCGGAGG	LSU	fwd	Fungi	for sequencing LR0R products	Garbelotto et al. 1997
ITS1	30	TCCGTAGGTGAACCTGCGG	ITS	fwd	Fungi	excludes Sordariomycetes	White et al. 1990
ITS1F	90	CTTGGTCATTTAGAGGAAGTAA	ITS	fwd	Fungi	excludes basal fungi and Tulasnella	Gardes & Bruns 1993
ITS1Fngs	90	GGTCATTTAGAGGAAGTAA	ITS	fwd	Fungi	excludes basal fungi and Tulasnella	Tedersoo et al. 2015a,b
ITS1ngs	30	TCCGTAGGTGAACCTGC	ITS	fwd	Fungi	excludes Sordariomycetes	Tedersoo et al. 2015a,b
ITS2	40	GCTGCGTTCTTCATCGATGC	ITS	fwd	Universal	excludes some Agaricales, Tremellales	White et al. 1990
ITS3	40	GCATCGATGAAGAACGCAGC	ITS	fwd	Universal	excludes Cantharellales	White et al. 1990
ITS3mix1-5	40	CANCGATGAAGAACGYRG	ITS	fwd	Universal	excludes Tulasnellaceae	Tedersoo et al. 2014
ITS4	40	TCCTCCGCTTATTGATATGC	ITS	rev	Universal	has central mismatches to some groups and Metazoa and Archaeorhizomycetes	White et al. 1990
ITS4ngs	40	TCCTSCGCTTATTGATATGC	ITS	rev	Universal	has central mismatches to some groups and Metazoa and Archaeorhizomycetes	White et al. 1990
ITS5	50	GGAAGTAAAAGTCGTAACAAGG	ITS	fwd	Universal	best sequencing primer for ITSOf/1F products	White et al. 1990
fITS7	70	GTGARTCATCGAATCTTTG	ITS	fwd	Fungi	excludes ca 2% minor groups	Ihrmark et al. 2012
fITS7R	70	CAAAGATTCGATGAYTCAC	ITS	rev	Fungi	excludes ca 2% minor groups	L. Tedersoo, unpublished
gITS7	70	GTGARTCATCGARTCTTTG	ITS	fwd	Fungi	excludes ca 2% minor groups	Ihrmark et al. 2012
ITS86F	70	GTGAATCATCGAATCTTTGAA	ITS	fwd	Fungi, Plants	excludes ca 2% minor groups and Tulasnellaceae	Turenne et al. 1998
fITS9	55	GAACACAGCGAAATGTGA	ITS	fwd	Fungi	excludes ca 4% minor groups	Ihrmark et al. 2012
ITS9mun	190	TGTACACACCGCCCGTCG	ITS	fwd	Fungi, Plants	little used	Egger 1995
ITSOF	90	ACTTGGTCATTTAGAGGAAGT	ITS	fwd	Fungi	outperforms ITS1F	Tedersoo et al. 2008
LF340	336	TACTTGTKCGCTATCGG	ITS	rev	Universal	for sequencing LB-W products	Tedersoo et al. 2008
LF402	402	TTCCCTTTYARCAATTTCAC	ITS/LSU	rev	Fungi	excludes chytrids, Basidio-yeasts,etc.	Tedersoo et al. 2015a,b
LF402F	402	GTGAAATTGYTRAAAGGGAA	LSU	fwd	Fungi	excludes chytrids, Basidio-yeasts,etc.	Tedersoo et al. 2015a,b
LR0B	15	GGTAGTCCTACCTGATTTG	ITS	rev	Basidiomycota	excludes several groups incl Sebacinales	L. Tedersoo, unpublished
LR0R	24	ACCCGCTGAACTTAAGC	LSU	fwd	Universal	widely used for LSU	Hopple & Vilgalys 1994
LR21	370	ACTTCAAGCGTTTCCCTTT	ITS/LSU	rev	Fungi	excludes many Asco- and Basidiomycota	Hopple & Vilgalys 1994
LR3	670	CCGTGTTTCAAGACGGG	ITS/LSU	rev	Universal	widely used for LSU	Hopple & Vilgalys 1994
LR3R	670	GTCTTGAAACACGGACC	LSU	fwd	Universal	widely used for LSU	Hopple & Vilgalys 1994
LR5	990	TCCTGAGGGAAACTTCG	LSU	rev	Universal	widely used for LSU	Hopple & Vilgalys 1994
LR5-Fung	900	CGATCGATTTGCACGTCAGA	LSU	rev	Fungi	excludes plants, alveolates and rhizarians, but not stramenopiles or animals	Tedersoo et al. 2008
LR6	1165	CGCCAGTTCTGCTTACC	LSU	rev	Universal	fair performance	Hopple & Vilgalys 1994
LR7	1475	TACTACCACCAAGATCT	LSU	rev	Universal	widely used for LSU	Hopple & Vilgalys 1994
nLSU1221r	1210	CTAGATGAACYAACACCTT	LSU	rev	Fungi	not enough tested	Schadt et al. 2003
NS7a	1430	CAATAACAGGTCTGTGATGC	SSU/ITS	fwd	Universal	widely used	White et al. 1990 (modified)
TW13	635	GGTCCGTGTTTCAAGACG	ITS/LSU	rev	Universal	analogue of LR3	T.J. White, unpublished
TW14	950	GCTATCCTGAGGGAAACTTC	LSU	rev	Universal	analogue of LR5	T.J. White, unpublished
Fungal clade-specific primers rDNA
ITS3Seb	150	TGAGTGTCATTGTAATCTCAC	ITS	fwd	Sebacinales	excludes ca 20% of target Sebacinales	M.Berbee, unpublished
ITS4B	200	CAGGAGACTTGTACACGGTCCAG	ITS	rev	Basidiomycota	excludes ca 40% of target taxa	Gardes & Bruns 1993
ITS4B1	200	CAAGRGACTTRTACACGGTCCA	ITS	rev	Basidiomycota	update of ITS4B, still excludes 20% of taxa	Tedersoo et al. 2007
ITS4-Cg	100	CACATGGCAARGGCAACCG	ITS	rev	Cenococcum	for improved sequence quality	Bahram et al. 2011
ITS4-Clav	20	GGTAGTCCCACCTGATTC	ITS	rev	Clavulina, Cantharellus p.p.	for improved sequence quality	Tedersoo et al. 2011
ITS4-GloeT	200	CACAGAAAGCACTTCTCTAA	ITS	rev	Gloeotulasnella	for improved sequence quality	L. Tedersoo, unpublished
ITS4-Russ	20	AGCGGGTAGTCTCACCC	ITS	rev	Russulaceae	for improved sequence quality	Tedersoo et al. 2011
ITS4-Seb	20	TCAGCGGGTARTCCTACTC	ITS	rev	Sebacina clade A	for improved sequence quality	Tedersoo et al. 2011
ITS4-Sord	100	CCCGTTCCAGGGAACTC	ITS	rev	Sordariomycetes	for improved sequence quality	Tedersoo et al. 2009
ITS4-Tom	150	AACTCGGACGACCAGAGGCA	ITS	rev	Tomentella, Thelephora	excludes 5-10% of Thelephoraceae	Tedersoo et al. 2011
ITS4-Tuber	230	CTCGACTCGTAGAAGRCACT	ITS	rev	Tuberaceae	not enough tested	Bonito et al. 2013
ITS4-Tul	120	CCGCCAGATTCACACATTGA	ITS	rev	Tulasnellaceae	excludes ca 30% of Tulasnellaceae!	Taylor & McCormick, 2008
ITS4-Tul2	50	TTCTTTTCCTCCGCTGAWTA	ITS	rev	Tulasnella (divergent)	complements to ITS4 and ITS4-Tul for divergent Tulasnellas	Oja et al. 2015
LA-W	360	CTTTTCATCTTTCGATCACTC	ITS	rev	Ascomycota	excludes some yeasts, fair PCR product	Tedersoo et al. 2008
LB-W	360	CTTTTCATCTTTCCCTCACGG	ITS	rev	Basidiomycota, Zygomycota, Plantae	excludes smuts, some Cantharellus	Tedersoo et al. 2008
LB-wR	350	GCGAACAAGTACCGTGAGG	LSU	fwd	Basidiomycota, Zygomycota, Plantae	excludes smuts, some Cantharellus	L. Tedersoo, unpublished
LB-y	870	TTTGCACGTCAGAATCGCTA	LSU	rev	Basidiomycota (excludes Plantae, other fungi)	good for root tip LSU (excludes some Tulasnella)	Tedersoo et al. 2008
LB-z	1120	AAAAATGGCCCACTAGAAACT	LSU	rev	Basidiomycota	good for root tip LSU, excludes some Cantharellus	Tedersoo et al. 2008
LB-Z-Sord	1020	GTTTGAGAATGGATGAAGGC	LSU	rev	Sordariomycetes	not enough tested	Tedersoo et al. 2009
LR0R-Tul2	40	CGTTGATTTAAGCATATTAWTC	LSU	fwd	Tulasnella (divergent)	reverse of ITS4-Tul2; not enough tested	L. Tedersoo, unpublished
LR21-Ath	280	CCAAACAACTCGACTCTTC	ITS	rev	Atheliales	not enough tested	L. Tedersoo, unpublished
LR21-Cenoc	460	GATGAGCAACATCAGGCAG	ITS	rev	Cenococcum	not enough tested	L. Tedersoo, unpublished
LR21-Cer	300	CGACTCGTTGAGAGCACAA	ITS	rev	Ceratobasidiaceae	not enough tested	Tedersoo et al. 2011
LR3-Aln	630	CCTSAGCACGAACGTGGTA	ITS/LSU	rev	Alnicola, Hebeloma, Entoloma, Inocybe p. parte	for improved sequence quality	L. Tedersoo, unpublished
LR3-Asc	680	CACYTACTCAAATCCWAGCG	LSU	rev	Ascomycota	not enough tested	Tedersoo et al. 2009
LR3-Cenoc	580	TTCAGGCTGGCCGCATTTC	ITS/LSU	rev	Cenococcum	not enough tested	L. Tedersoo, unpublished
LR3End	650	AYCATTAMGTCAGCGACCTA	LSU	rev	Endogonales	not enough tested	L. Tedersoo, unpublished
LR3-Pez	930	CMTCRGGATCGGTCGATGG	ITS/LSU	rev	Pezizales	excludes 20% of Pezizales	Tedersoo et al. 2011
LR3-Tul	570	GACTCGCATGCAAGGTRCA	ITS/LSU	rev	Tulasnellaceae	excludes 20% of Tulasnellaceae	L. Tedersoo, unpublished
LR5-Cer	860	CTCTGGCTTCACCCTATG	ITS/LSU	rev	Ceratobasidiaceae	not enough tested	L. Tedersoo, unpublished
LR5-Fung	880	CGATCGATTTGCACGTCAGA	LSU	rev	Fungi, Metazoa (excl. Plantae)	good for plant tissues	Tedersoo et al. 2008
LR5-Seb	1000	ATTCGCTTTACCGCACAAGG	LSU	rev	Sebacinales	not enough tested	Tedersoo et al. 2008
LR5-Tom	740	CTACCGTAGAACCGTCTCC	ITS/LSU	rev	Tomentella, Thelephora	excludes 10% of Thelephoraceae	Tedersoo et al. 2008
LR6 Leot-Sord	1100	AAAATGGCCCACTAGTGTTG	LSU	rev	Leotiomycetes, SordarioM	not enough tested	Tedersoo et al. 2011
LR6-Asc	1100	AAAATGGCCCACTAGTAACG	LSU	rev	Ascomycota, v.a. Leot,SordM	not enough tested	Tedersoo et al. 2011
LR6-Pez	1100	CCTCATAAAACRAKATCGTTAC	LSU	rev	Pezizales	not enough tested	L. Tedersoo, unpublished
LSUmAr	930	[composite]	ITS/LSU	rev	Glomeromycota	good for AMF	Krüger et al. 2009
LSUmBr	840	[composite]	ITS/LSU	rev	Glomeromycota	good for AMF	Krüger et al. 2009
NL6Amun	420	CAAGTGCTTCCCTTTCAACA	ITS	rev	Ascomycota	not specific, excludes many groups; 1-2 mismatches to Archaeorhizomycetes	Egger 1995
NL6Bmun	420	CAAGCGTTTCCCTTTCAACA	ITS	rev	Basidiomycota	not specific, excludes many groups
SSUmAf	300	[composite]	ITS	fwd	Glomeromycota	good for AMF	Krüger et al. 2009
SSUmCf	250	[composite]	ITS	fwd	Glomeromycota	good for AMF	Krüger et al. 2009
Universal, fungal SSU
FF1100	580	CCAGCTCCAATAGCGTATATTA	SSU	fwd	Fungi		Vainio & Hantola 2000
FF700	980	GATACCGTIGTAGTCT	SSU	fwd	Fungi		Vainio & Hantola 2000
FF390	1290	CGATAACGAACGAGACCT	SSU	fwd	Fungi		Vainio & Hantola 2000
FR1	1680	AICCATTCAATCGGTAIT	SSU	rev	Fungi		Vainio & Hantola 2000
SSU515f	500	GTGCCAGCMGCCGCGGTAA	SSU	fwd	Euakryote/Prokaryote	Cross-domain primer	Turner et al. 1999
SSU515Fngs	500	GCCAGCAACCGCGGTAA	SSU	fwd	Euakryote/Prokaryote		Tedersoo et al. 2015a,b
SSU0817f	790	TTAGCATGGAATAATRRAATAGGA	SSU	fwd	Eukaryote		Borneman & Hartin 2000
SSU1196R	1170	TCTGGACCTGGTGAGTTTCC	SSU	rev	Eukaryote		Borneman & Hartin 2000
SSU1196Rngs	1170	TCTGGACCTGGTGAGTTT	SSU	rev	Eukaryote		Tedersoo et al. 2015a,b
SSU1391R	1360	GACGGGCGGTGWGTRCA	SSU	rev	Eukaryote		Turner et al. 1999
SSU1536R	1490	ATTGCAATGCYCTATCCCCA	SSU	rev	Eukaryote		Borneman & Hartin 2000
EF4	120	GGAAGGGRTGTATTTATTAG	SSU	fwd	Eukaryote		Smit et al. 1999
EF3	1700	TCCTCTAAATGACCAAGTTTG	SSU	rev	Eukaryote		Smit et al. 1999
Fung5	680	GTAAAAGTCCTGGTTCCCC	SSU	rev	Fungi	excludes 10% groups incl. ArchaeorhizoM	Smit et al. 1999
AM1	1150	GTTTCCCGTAAGGCGCCGAA	SSU	rev	Glomeromycota	excludes early diverging groups	Helgason et al. 1998
AML1	230	ATCAACTTTCGATGGTAGGATAGA	SSU	rev	Glomeromycota		Lee et al. 2008
AML2	1170	GAACCCAAACACTTTGGTTTCC	SSU	rev	Glomeromycota		Lee et al. 2008
NS1	30	GTAGTCATATGCTTGTCTC	SSU	fwd	Eukaryote		White et al. 1990
NS2	560	GGCTGCTGGCACCAGACTTGC	SSU	rev	Eukaryote		White et al. 1990
NS7	1400	GAGGCAATAACAGGTCTGTGATGC	SSU	fwd	Eukaryote		White et al. 1990
NS6	1400	GCATCACAGACCTGTTATTGCCTC	SSU	rev	Eukaryote		White et al. 1990
NS3	560	GCAAGTCTGGTGCCAGCAGCC	SSU	fwd	Eukaryote		White et al. 1990
NS4	1120	CTTCCGTCAATTCCTTTAAG	SSU	rev	Eukaryote		White et al. 1990
NS5	1140	AACTTAAAGGAATTGACGGAAG	SSU	fwd	Eukaryote		White et al. 1990
NS8	1770	TCCGCAGGTTCACCTACGGA	SSU	rev	Eukaryote		White et al. 1990
NS20	860	CGTCCCTATTAATCATTACG	SSU	rev	Eukaryote		White et al. 1990
NS24	1760	AAACCTTGTTACGACTTTTA	SSU	rev	Eukaryote		White et al. 1990
NS31	535	TTGGAGGGCAAGTCTGGTGCC	SSU	fwd	Fungi	widely used	Simon et al. 1992
Euk742R	890	AAATCCAAGAATTTCACCTCT	SSU	rev	Eukaryote	poor performance	Tedersoo et al. 2015a,b
Plant ITS primers
RydinF	70	GAACCTTATCRTTTAGAGGAAGG	ITS	fwd	Plantae
Rydin R	50	CCGCCAGATTTTCACGCTGGGC	ITS	rev	Plantae
ITS4Ang	20	GTARTCCCGCCTGACCTG	ITS	rev	Angiospermae
ITS4PL	260	TTCCCAAACAACCCGACTCG	ITS	rev	Plantae	matches many fungi
ITS-OP	70	ttaTCATTTAGAGGAAGgAg	ITS	fwd	Plantae	plant analogue of ITS1F
PN16	400	TCCCTTTCAACAATTTCACG	ITS/LSU	rev	Plantae	excludes many groups
18S-IGS	20	ACTACTGGCAGGATCAACCAG	IGS	rev	Plantae, Fungi
Primers for chloroplast markers
trnL-c	.	CGAAATCGGTAGACGCTACG	trnL	fwd	Plantae
trnL-d	.	GGGGATAGAGGGACTTGAAC	trnL	rev	Plantae
trn F	.	ATTTGAACTGGTGACACGAG	trnL	rev	Plantae
trn E	.	GGTTCAAGTCCCTCTATCCC	trnL	fwd	Plantae
trn H	.	CGCGCATGGTGGATTCACAATCC	trnL	fwd	Plantae
psbA	.	GTTATGCATGAACGTAATGCTC	trnL	rev	Plantae
atpF	.	GAAGTAGTAGGATTGATTCTC	rbcL	rev	Plantae
rbcL	.	CCCTACAACTCATGAATTAAG	rbcL	fwd	Plantae
Oomycete primers
ITS1Oo	0	GGAAGGATCATTACCACAC	ITS	fwd	Oomycota (99%)		L. Tedersoo, unpublished
ITS2Oo	40	GCAGCGKTCTTCATCGRTGT	ITS	fwd	Oomycota (99%)		L. Tedersoo, unpublished
ITS3Oo	150	AGTATGYYTGTATCAGTGTC	ITS	fwd	Oomycota (99%)		T. Riit, unpublished
ITS3Perofascia	140	CCACCTATGCTACGCTATG	ITS	fwd			T. Riit, unpublished

https://unite.ut.ee/primers.php

Primer for bacterial

Angela M Orshinsky added an answer

April 8, 2013

For fungi: http://onlinelibrary.wiley.com/doi/10.1111/j.1755-0998.2009.02635.x/full They describe and evaluate the benefits of different standard primer targets and make a good case for ITS4 and ITS5 as universal fungal primers.

For bacteria: http://www.plosone.org/article/info:doi/10.1371/journal.pone.0049755

The authors prefer chaperonin as a target for bacterial species identification from environmental samples.

https://www.researchgate.net/publication/14414018_Predominance_of_two_Bartonella_henselae_variants_among_cat-scratch_disease_patients_in_The_Netherlands/figures?lo=1
> bac dung 16SF và 16S R
> rpoB la gi?